Question 2. Design PCR primers for the human MyD88 gene. Be sure to list each primer…

Question 2.

Design PCR primers for the human MyD88gene. Be sure to list each primer from 5’ to 3’ and give the melting temperatures of each primer.

VERY IMPORTANT:Your primers should be designed so you can express MyD88 using the pcDNA6 expression vector which contains the sequence for a His-tag downstream of the MCS. You must clone the MyD88 PCR product into the KpnI site in such a way that the expressed protein will have a C-terminal His-tag. The KpnI recognition sequence is GGTACC and the cut site looks like this:

5’ GGTAC C 3’

3’ C CATGG 5’

MyD88 coding DNA:

atgcgacccgaccgcgctgaggctccaggaccgcccgccatggctgcag

gaggtcccggcgcggggtctgcggccccggtctcctccacatcctccct

tcccctggctgctctcaacatgcgagtgcggcgccgcctgtctctgttc

ttgaacgtgcggacacaggtggcggccgactggaccgcgctggcggagg

agatggactttgagtacttggagatccggcaactggagacacaagcgga

ccccactggcaggctgctggacgcctggcagggacgccctggcgcctct

gtaggccgactgctcgagctgcttaccaagctgggccgcgacgacgtgc

tgctggagctgggacccagcattgaggaggattgccaaaagtatatctt

gaagcagcagcaggaggaggctgagaagcctttacaggtggccgctgta

gacagcagtgtcccacggacagcagagctggcgggcatcaccacacttg

atgaccccctggggcatatgcctgagcgtttcgatgccttcatctgcta

ttgccccagcgacatccagtttgtgcaggagatgatccggcaactggaa

cagacaaactatcgactgaagttgtgtgtgtctgaccgcgatgtcctgc

ctggcacctgtgtctggtctattgctagtgagctcatcgaaaagaggtt

ggctagaaggccacggggtgggtgccgccggatggtggtggttgtctct

gatgattacctgcagagcaaggaatgtgacttccagaccaaatttgcac

tcagcctctctccaggtgcccatcagaagcgactgatccccatcaagta

caaggcaatgaagaaagagttccccagcatcctgaggttcatcactgtc

tgcgactacaccaacccctgcaccaaatcttggttctggactcgccttg

ccaaggccttgtccctgccctga

Forward Primer =

Tm =

Reverse Primer =

Tm =

How many amino acids are there in MyD88?

Refer to the sequence of the MCS of pcDNA6 shown below to design primers to clone the MyD88 gene into pcDNA6 using the BamHI and EcoRI sites ensuring that the expressed protein will be in frame with the His-tag.

Forward Primer =

Tm =

Reverse Primer =

Tm =

"Is this question part of your assignment? We can help"

ORDER NOW